If you have been reading about peptidase and want a single page that covers the useful parts, this is it: definitions, context, how it is studied, and the questions that come up repeatedly.
Last reviewed on 2025-08-15. Where a claim depends on a specific study, the study is described rather than over-claimed.
Proposed mechanisms centre on the GABAergic system. Animal and tissue studies report changes in GABA-A receptor expression and reduced activity of GABA transaminase, the enzyme that degrades GABA. Effects on monoamine turnover, including serotonin and dopamine pathways, are also described, and a separate line of work links the peptide to increased expression of brain-derived neurotrophic factor in hippocampal tissue. Most of these findings come from rodent models and cell preparations. How the individual observations combine into a single coherent mode of action is not settled.
Pharmacokinetic data are sparse and largely derived from animal work. After intranasal administration the peptide appears in plasma within minutes, and reported half-lives are short, on the order of minutes to tens of minutes. Degradation proceeds through ordinary proteolytic cleavage into constituent amino acids and smaller fragments. Direct evidence that intact Selank reaches brain tissue in meaningful amounts is limited, and the extent of blood-brain barrier penetration is debated. Some authors argue that fragments, not the parent peptide, carry much of the observed activity.
The compound was designed at the Institute of Molecular Genetics of the Russian Academy of Sciences during the 1980s and 1990s. The stated design goal was to retain the immunomodulatory and central nervous system activity attributed to tuftsin while improving resistance to enzymatic breakdown. Adding a proline-rich tail to the short parent peptide was a deliberate strategy, because proline residues restrict the conformations available to many peptidases. The same laboratory produced Semax, an ACTH fragment analog, and both compounds were developed in parallel as short, enzymatically stabilized peptides intended for intranasal use.
Selank is not a naturally occurring peptide and has no known endogenous counterpart in human physiology. Russian-language sources frequently call it TP-7, while English-language sources use the name Selank almost exclusively. Database indexing is uneven, partly because early reports appeared in regional journals that are not widely cataloged. Some summaries describe the material as a tuftsin analog and others as a synthetic heptapeptide; the labels overlap rather than conflict. Citing the primary sequence resolves ambiguity more reliably than the research or trade name alone.
Selank is a synthetic heptapeptide with the sequence Thr-Lys-Pro-Arg-Pro-Gly-Pro, written TKPRPGP in one-letter notation. Its structure consists of the immunomodulatory tetrapeptide tuftsin, Thr-Lys-Pro-Arg, extended at the carboxyl terminus by a Pro-Gly-Pro segment. The molecular formula is commonly given as C33H57N11O9, corresponding to a monoisotopic mass near 751.4 Da and an average molecular mass near 751.9 Da. All seven residues are proteinogenic amino acids, and the molecule carries no modified side chains or non-natural linkages.
| Property | Value | Notes |
|---|---|---|
| Primary route studied | Intranasal | Also examined parenterally in animal work |
| Reported plasma half-life | Minutes to tens of minutes | Values vary widely between reports |
| Main model systems | Rodent behavioural and cell assays | Human trials are few and small |
| Principal proposed targets | GABA-A receptor, GABA transaminase | Monoamine and neurotrophic pathways also reported |
| Evidence grade | Preliminary | Limited independent replication |
Selank is a synthetic heptapeptide with the sequence Thr-Lys-Pro-Arg-Pro-Gly-Pro. It was designed at the Institute of Molecular Genetics of the Russian Academy of Sciences as a structural analogue of tuftsin, a naturally occurring tetrapeptide fragment of the immunoglobulin heavy chain. The added Pro-Gly-Pro tail was intended to slow enzymatic degradation and extend biological activity. In Russia it is registered as an anxiolytic nasal preparation, while regulators elsewhere have not approved it for clinical use.
Proposed mechanisms centre on modulation of the GABAergic system, with reports of altered expression of genes related to GABA-A receptor subunits and changed monoamine turnover. Some studies describe inhibition of enkephalinase, the enzyme that degrades endogenous enkephalins, which may prolong opioid peptide signalling. Effects on brain-derived neurotrophic factor and on cytokine expression have also been reported. These findings come largely from animal models and small human studies, and the precise primary target remains unresolved.
Published clinical evidence is limited. Most controlled trials were conducted in Russia, enrolled modest numbers of participants, and appeared in Russian-language journals, which restricts independent verification. Reported outcomes include lower anxiety scores, improved attention and memory measures, and changes in fatigue ratings. Reviews written in English note methodological limitations such as small samples and inconsistent endpoints. Whether the compound produces clinically meaningful benefit relative to established anxiolytics is therefore an open question rather than an established finding.
Selank is a synthetic heptapeptide developed in Russia as a structural analogue of tuftsin, a naturally occurring immunomodulatory tetrapeptide. Its sequence, Thr-Lys-Pro-Arg-Pro-Gly-Pro, keeps the tuftsin core at the N-terminus and appends a Pro-Gly-Pro tail. Researchers at the Institute of Molecular Genetics in Moscow synthesized the compound during the 1990s while searching for peptides with combined anxiolytic and immunomodulatory activity. The added tail was intended to resist enzymatic cleavage and prolong the molecule's presence in circulation.
The compound has a calculated molecular weight near 751.9 daltons and carries a net positive charge at physiological pH because of its arginine residue. It dissolves freely in water and in common aqueous buffers, and typically appears as a white or off-white lyophilized powder. The amide backbone makes the molecule susceptible to peptidases, which limits oral use and favors intranasal or parenteral routes. Nomenclature in the literature varies: the substance is also described by the sequence abbreviation TP-7 and by a Russian trade designation.
Regulatory status differs sharply by region. Selank holds a Russian marketing authorization, where it is supplied mainly as nasal drops, while authorities elsewhere have not approved it for medical use. Material sold internationally is therefore usually labeled as a research chemical rather than a medicine. Peer-reviewed publications come predominantly from Russian laboratories, and sample sizes are generally small. Whether the compound produces comparable effects under independent, well-controlled replication remains an open question that the broader literature has not settled.
Selank is a synthetic heptapeptide developed in Russia. Its sequence is Thr-Lys-Pro-Arg-Pro-Gly-Pro, a seven-residue chain built around the natural tetrapeptide tuftsin. Researchers at the Institute of Molecular Genetics of the Russian Academy of Sciences first described the compound in the mid-1990s. The design combined the tuftsin core with an added Pro-Gly-Pro tail, a modification intended to extend the molecule's stability in biological fluids. Published work on the peptide has appeared mainly in Russian-language journals.
Reported activity for Selank centers on anxiolytic and nootropic effects. Russian clinical reports describe use in anxiety and in cognitive or attention-related complaints. Most of this evidence comes from studies conducted by the same research groups that developed the peptide. Independent replication in other countries remains limited, and no major Western regulatory agency has approved the compound for any indication. The gap between local reports and external verification is a recurring point in discussions of the peptide.
Once dissolved, the peptide is markedly less stable than the dry powder. Aqueous solutions are subject to backbone hydrolysis and to microbial growth when they are handled without sterile technique. Buffered solutions near neutral pH are common for short-term laboratory work, while acidic conditions are sometimes used to improve solubility. Analytical laboratories generally prepare working solutions fresh rather than storing them, and a residual water film left in a reopened vial can seed degradation even when the container appears dry.
Reversed-phase high-performance liquid chromatography is the standard technique for estimating peptide purity. The result is a peak-area percentage, which describes how much of the detected material elutes as the main peak in one run. Mass spectrometry confirms the molecular mass and can reveal truncated, adducted, or otherwise modified species. Amino acid analysis or tandem mass spectrometry can address sequence fidelity when identity is in doubt. None of these measurements, taken alone, establishes that a sample is fit for any specific purpose.
SNX8 contains a PX domain in its N-terminus, which is located between amino acids 71 and 181. A homology domain with yeast's PX domain is localized between amino acids 75 and 178 within this same domain. As it is a phosphoinositide-binding domain, it is important to highlight amino acids 109, 135 and 148 as residues directly related to phosphatidylinositol 3-phosphate since being specific binding sites, constituting a phosphoinositid binding site with a span of 40 amino acids. Furthermore, it includes a pair of phosphorylable tyrosines in positions 95 and 126 that are key in its function in the IFNγ-triggered IKKβ-mediated noncanonical signaling pathway. Overall, the PX domain main function is to target SNX8 mainly to early endosomes and other membranes rich in phosphatidylinositol 3-phosphate phospholipids.
How the secretion of motilin is regulated is largely unknown, although some studies suggest that an alkaline pH in the duodenum stimulates its release. However, at low pH it inhibits gastric motor activity, whereas at high pH it has a stimulatory effect. Some studies in dogs have shown that motilin is released during fasting or interdigestive period, and intake of food during this period can prevent the secretion of motilin. Intravenous injection of glucose, which increases the release of insulin, is also found to inhibit cyclic elevation of plasma motilin. Other studies on dogs have also suggested that motilin acted as endogenous ligand in positive feedback mechanism to stimulate the release of more motilin. In dogs and cats, motilin secretion is stimulated by hydrogen ions (protons) and lipids when the animal is in a "fed" state. However, during fasting, motilin is periodically released into the serum to initiate phase III of the migrating motor complex.
He made one of his final TV appearances during season 5 on Oprah: Where Are They Now? He voiced characters in the television series Captain Planet and the Planeteers, Fish Police, and Happily Ever After: Fairy Tales for Every Child. He was known for the voice of Rafiki in the movie The Lion King and its sequels and spin-offs. He lent his deep tenor voice as Mr. Thicknose in The Land Before Time VIII: The Big Freeze. He also supplied the voice for Eli Vance in the 2004 video game Half-Life 2 and its episodic sequels.
The 2014 Farm Bill legalized the sale of "non-viable hemp material" grown within states participating in the Hemp Pilot Program which defined hemp as cannabis containing less than 0.3% of THC. The 2018 Farm Bill removed the hemp plant and all "derivatives, extracts, cannabinoids, isomers, acids, salts, and salts of isomers, whether growing or not, with a delta-9 tetrahydrocannabinol concentration of not more than 0.3 percent on a dry weight basis," including CBD, from the Controlled Substances Act, making them legal to manufacture in the United States. The FDA retains regulatory authority over hemp-derived CBD, while the DEA is not involved in the regulation of legally-compliant hemp and hemp products. The 2018 Farm Bill requires that research and development of CBD for a therapeutic purpose would have to be conducted under notification and reporting to the FDA. On April 23, 2026, the Department of Justice issued an order to immediately reclassify medical cannabis as a Schedule III controlled substance when dispensed by a state-licensed cannabis dispensary. The DEA is in the process of conducting expedited public hearings to address the broader rescheduling of all cannabis from Schedule I to Schedule III, with the hearings scheduled to begin June 29, 2026.
Sources: en.wikipedia.org
Many pharmaceuticals are derived from petroleum, albeit via multi-step processes. Modern medicine depends on petroleum as a source of building blocks, reagents, and solvents. Similarly, virtually all pesticides, insecticides, and herbicides are derived from petroleum. Pesticides have profoundly affected life expectancies by controlling disease vectors and by increasing crop yield. Like pharmaceuticals, pesticides are in essence petrochemicals. Almost all plastics and synthetic polymers are derived from petroleum, which is the source of monomers. Alkenes (olefins) are one important class of these precursor molecules.
=== Polyadenylation === Based on software analysis of the mRNA sequences various polyadenylation patterns could be identified for the transcription variants . TV1 and TV2 share the same pattern located on exon 10 starting at position 1246 resulting in a 32 nucleotide motif (AGUAGAGUCUGCGCUGUGACCUUCUGUUGGGC). TV3 uses a motif on exon 11 at the position 320. The motif is also 32 nucleotides long, but differs from the sequence used by TV1/2 (AGUGGCUUGUUCCACCUCAGCUCCCAUCUAAC). The difference in the polyadenylation sequence results in a variance of the minimum free energy values of the predicted RNA folding structures (-28.70 kcal/mol, TV1 and TV2 and -16.03 kcal/mol, TV3), which could result in different length of the Poly-A tail. Based on the observation that stable secondary structures result in decreased polyadenylation of the specific site, this might indicate that TV1 and TV2 are less polyadenylated in comparison to TV3.
Marxism–Leninism–Maoism–Prachanda Path (Nepali: मालेमावाद र प्रचण्डपथ Mālemāvād ra Prachaṇḍapath; sometimes shortened to Prachanda Path) is the ideological line of the Communist Party of Nepal (Maoist Centre), also known as the CPN (MC). It is considered a development of Marxism–Leninism–Maoism (MLM) and named after the leader of the CPN (MC), Pushpa Kamal Dahal, commonly known as Prachanda. Prachanda Path was proclaimed in 2001. The ideology was partially inspired by the example of the Communist Party of Peru – Shining Path, which refers to its ideological line as Marxism–Leninism–Maoism–Gonzalo Thought. Prachanda Path does not claim to make an ideological break with Marxism, Leninism or Maoism, but rather to be an extension of these ideologies based on the politics of Nepal. The doctrine came into existence after the party determined that the ideologies of Marxism, Leninism and Maoism could no longer be practiced completely as they had been in the past. The party adopted Prachanda Path as they felt it was a suitable ideology based on the reality of Nepalese politics. Militarily and in the context of the 1996–2006 civil war in Nepal, central to the ideology was the achievement of revolution through the control of rural areas and the encirclement of urban settlements. The CPN (MC) was seen to have abandoned Maoism in its decision to merge with the Communist Party of Nepal (Unified Marxist–Leninist) to form the Nepal Communist Party, but this party has since been disestablished and the CPN (MC) reconstituted.
Sources: en.wikipedia.org
Reports describe modulation of GABA signalling, changes in monoamine turnover and effects on neurotrophic factor expression. These observations come mainly from animal and cell studies. A single unifying mechanism has not been demonstrated.
The peptide enters plasma rapidly and is broken down by ordinary proteases into amino acids and shorter fragments. Reported half-lives are short. Whether meaningful amounts of the intact molecule reach the brain is an open question.
Most clinical reports are small, published in Russian and not independently replicated. English-language reviews highlight the absence of large randomised trials. Conclusions about efficacy should be treated as provisional.
The sequence is Thr-Lys-Pro-Arg-Pro-Gly-Pro, written TKPRPGP in one-letter code. It combines the tetrapeptide tuftsin with a carboxyl-terminal Pro-Gly-Pro extension. This full sequence identifies the molecule more precisely than the research name.